This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKPRB00002424


Marker Name:  P2Y5 
Species:  Chicken
Marker Type:  Probe
Publication ID: 16533368

PCR Primers

Primer: GCAAGCTTCTTCCAGTCCAC
Primer: GGCTTAACGTAAGCGGTTTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L06109

Related Markers

This Marker is Associated with Gene P2Y5

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Cytogenetic Map: Cytogenetic Map Chicken
chromosome 1
0.820 0.840 0.860


© The Roslin Institute 2007-2012, all rights reserved