This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKPRB00002422


Marker Name:  SOD1 
Species:  Chicken
Marker Type:  Probe
Publication ID: 16533368

PCR Primers

Primer: CGAGGTCCAGCATTTCCAGT
Primer: GTCATGTAATGCGGTGCCTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF315328

Related Markers

This Marker is Associated with Gene SOD1

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Cytogenetic Map: Cytogenetic Map Chicken
chromosome 1
0.540 0.560 0.580


© The Roslin Institute 2007-2012, all rights reserved