This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKPRB00002421


Marker Name:  HSD3B 
Species:  Chicken
Marker Type:  Probe
Publication ID: 16533368

PCR Primers

Primer: TGTGTGCTGAAGGCAGATGG
Primer: TGCCTCTTCCCATGTGTAACG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: D43762

Related Markers

This Marker is Associated with Gene HSD3B

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Cytogenetic Map: Cytogenetic Map Chicken
chromosome 1
0.420 0.440 0.460


© The Roslin Institute 2007-2012, all rights reserved