This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00053673


Marker Name:  CH242-247L10 
Species:  Pig
Marker Type:  PCR-RFLP
Publication ID: 16734700

PCR Primers

Primer: AAGTTTGACATCCTGTGTTTGAG
Primer: TGGCAGTTGATTTTGGGTCT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: CT225968
has an Associated Sequence: Local Sequence ID: ARKFSQ00009218

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
53900173.000 53900300.000 53900427.000
ENSEMBL56 Sscrofa9 Pig Assembly: 17 Pig
chromosome 17
61824814.000 61824941.000 61825068.000
ENSEMBL67 Ssc10.2 Pig Assembly: 17 Pig
chromosome 17
66578360.000 66578487.000 66578614.000
Ramos, A.M et al 2006 (A): 17 Pig
chromosome 17
113.100 113.100 113.100


© The Roslin Institute 2007-2012, all rights reserved