This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00053669


Marker Name:  RPCI44-431M20 
Species:  Pig
Marker Type:  PCR-RFLP
Publication ID: 16734700

PCR Primers

Primer: ACTGCCGCTTCCTCGTTTTA
Primer: AGCCACTGTTCACCTCAGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009215
has an Associated Sequence: Sequence Genbank ID: CL412625

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
53732326.000 53732420.500 53732515.000
ENSEMBL56 Sscrofa9 Pig Assembly: 17 Pig
chromosome 17
61656967.000 61657061.500 61657156.000
ENSEMBL67 Ssc10.2 Pig Assembly: 17 Pig
chromosome 17
66410513.000 66410607.500 66410702.000
Ramos, A.M et al 2006 (A): 17 Pig
chromosome 17
110.700 110.700 110.700


© The Roslin Institute 2007-2012, all rights reserved