This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00053668


Marker Name:  RAB22A 
Species:  Pig
Marker Type:  PCR-RFLP
Publication ID: 16734700

PCR Primers

Primer: GGGTGCCTGAGTGAGGAAAG
Primer: TTGCATGGATGGAGTCGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: DQ239914
has an Associated Sequence: Local Sequence ID: ARKFSQ00009214

Related Markers

This Marker is Associated with Gene RAB22A

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
53238255.000 53238456.000 53238657.000
ENSEMBL56 Sscrofa9 Pig Assembly: 17 Pig
chromosome 17
61162896.000 61163097.000 61163298.000
ENSEMBL67 Ssc10.2 Pig Assembly: 17 Pig
chromosome 17
65771421.000 65771622.000 65771823.000
Ramos, A.M et al 2006 (A): 17 Pig
chromosome 17
108.900 108.900 108.900


© The Roslin Institute 2007-2012, all rights reserved