This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00053664


Marker Name:  RPCI44-332L18 
Species:  Pig
Marker Type:  PCR-RFLP
Publication ID: 16734700

PCR Primers

Primer: TGATAGATTGTGCTTCGATGG
Primer: AGATCACCCCAAGGGATTTT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: CL386051
has an Associated Sequence: Local Sequence ID: ARKFSQ00009210

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
52353684.000 52353931.500 52354179.000
ENSEMBL56 Sscrofa9 Pig Assembly: 17 Pig
chromosome 17
60278325.000 60278572.500 60278820.000
ENSEMBL67 Ssc10.2 Pig Assembly: 17 Pig
chromosome 17
64907127.000 64907374.500 64907622.000
Ramos, A.M et al 2006 (A): 17 Pig
chromosome 17
98.900 98.900 98.900


© The Roslin Institute 2007-2012, all rights reserved