This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00053658


Marker Name:  DOK5 
Species:  Pig
Marker Type:  PCR-RFLP
Publication ID: 16734700

PCR Primers

Primer: AACAGAGACTTTTCCCCCCTA
Primer: GTTTTTTGTTTATGAAAGAGG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009206
has an Associated Sequence: Sequence Genbank ID: DQ239907

Related Markers

This Marker is Associated with Gene DOK5

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
50151895.000 50152008.000 50152121.000
ENSEMBL56 Sscrofa9 Pig Assembly: 17 Pig
chromosome 17
58076536.000 58076649.000 58076762.000
ENSEMBL67 Ssc10.2 Pig Assembly: 17 Pig
chromosome 17
62547332.000 62547445.000 62547558.000
Ramos, A.M et al 2006 (A): 17 Pig
chromosome 17
88.300 88.300 88.300


© The Roslin Institute 2007-2012, all rights reserved