This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00053657


Marker Name:  CYP24A1 
Species:  Pig
Marker Type:  PCR-RFLP
Publication ID: 16734700

PCR Primers

Primer: ACGATACGCTGGTAAATGCC
Primer: CATAGCCCTCCTTGCGATAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: DQ239906
has an Associated Sequence: Local Sequence ID: ARKFSQ00009205

Related Markers

This Marker is Associated with Gene CYP24A1

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
49422224.000 49422435.000 49422646.000
ENSEMBL56 Sscrofa9 Pig Assembly: 17 Pig
chromosome 17
57359485.000 57359696.000 57359907.000
ENSEMBL67 Ssc10.2 Pig Assembly: 17 Pig
chromosome 17
61911224.000 61911435.000 61911646.000
Ramos, A.M et al 2006 (A): 17 Pig
chromosome 17
85.300 85.300 85.300


© The Roslin Institute 2007-2012, all rights reserved