This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00053656


Marker Name:  ATP9A 
Species:  Pig
Marker Type:  PCR-RFLP
Publication ID: 16734700

PCR Primers

Primer: TGGTTCTGGACAAAGATGTCA
Primer: ACACAAGAGCATTTCGAGGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: DQ239905
has an Associated Sequence: Local Sequence ID: ARKFSQ00009204

Related Markers

This Marker is Associated with Gene ATP9A

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
47201069.000 47201259.500 47201450.000
ENSEMBL56 Sscrofa9 Pig Assembly: 17 Pig
chromosome 17
55138330.000 55138520.500 55138711.000
ENSEMBL67 Ssc10.2 Pig Assembly: 17 Pig
chromosome 17
59386056.000 59386246.500 59386437.000
Ramos, A.M et al 2006 (A): 17 Pig
chromosome 17
83.600 83.600 83.600


© The Roslin Institute 2007-2012, all rights reserved