This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00053038


Marker Name:  RPL9 
Species:  Cow
Marker Type:  PCR-STS
Publication ID: 16542434

PCR Primers

Primer: TGAAGGGACGGACAGTTATTG
Primer: TCTTTTTCTTCCCAAGGAGAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW464197
has an Associated Sequence: Local Sequence ID: ARKFSQ00008016
has an Associated Sequence: Local Sequence ID: ARKFSQ00008015
has an Associated Sequence: Local Sequence ID: ARKFSQ00008017

Related Markers

This Marker is Associated with Gene RPL9

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL54 Btau_4.0 Cow Assembly: 11 Cow
chromosome 11
108066892.000 108066941.000 108066990.000
ENSEMBL54 Btau_4.0 Cow Assembly: 6 Cow
chromosome 6
60945232.000 60945281.000 60945330.000
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
107153726.000 107153775.000 107153824.000
Weikard, Rosemarie et al 2006: 6 Cow
chromosome 6
1560.300 1560.300 1560.300


© The Roslin Institute 2007-2012, all rights reserved