This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00052240


Marker Name:  CLDN2 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 16997530

PCR Primers

Primer: ATCACCCAGTGTGACATCTA
Primer: CAACAGGAATGAAGCCCAG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Murphy et al 2006: X Cat
chromosome X
791.600 791.600 791.600


© The Roslin Institute 2007-2012, all rights reserved