This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00052014


Marker Name:  39019848 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 16997530

PCR Primers

Primer: AACATTCACTTGTGGCCTCC
Primer: CAGGAAAGGGGGAAAGAGAC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Murphy et al 2006: D2 Cat
chromosome D2
754.400 754.400 754.400


© The Roslin Institute 2007-2012, all rights reserved