This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00051963


Marker Name:  39091213 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 16997530

PCR Primers

Primer: GCAGCTCTTGACTCTCGCTT
Primer: CTCCTTGCCTCTCTCATTGG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Murphy et al 2006: C2 Cat
chromosome C2
1458.500 1458.500 1458.500


© The Roslin Institute 2007-2012, all rights reserved