This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00051705


Marker Name:  39055743 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 16997530

PCR Primers

Primer: TGCTTCCTTTTTCACTGCCT
Primer: TCTCGTATTTCTGGCAGCCT
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Murphy et al 2006: A3 Cat
chromosome A3
784.200 784.200 784.200


© The Roslin Institute 2007-2012, all rights reserved