This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00051584

Marker Name:  EFNA5 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 16997530

PCR Primers

Primer: tttggcattttcatctggag
Primer: ccacctgactgctcatcct

Related Sequences

No Associated Sequences Found.

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Murphy et al 2006: A1 Cat
chromosome A1
1900.100 1900.100 1900.100

© The Roslin Institute 2007-2012, all rights reserved