This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00051581

Marker Name:  NR2F1 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 16997530

PCR Primers

Primer: ggttccctctcctcttcacc
Primer: cacaactatgaaaggacggttc

Related Sequences

No Associated Sequences Found.

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Murphy et al 2006: A1 Cat
chromosome A1
1845.400 1845.400 1845.400

© The Roslin Institute 2007-2012, all rights reserved