This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00028107


Marker Name:  DPEP1 
Species:  Pig
Marker Type:  PCR-STS
Publication ID: not available  

PCR Primers

Primer: CCTCGACTGCGTACCAATTCCCACTCCATCGACAGCAG
Primer: CGTGTCCACCAGCCAGTTGT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X53730

Related Markers

This Marker is Associated with Gene DPEP1
This Marker is Associated with Gene DPEP1

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Cao, H et al. 2004: 1 Pig
chromosome 6
991.000 991.000 991.000


© The Roslin Institute 2007-2012, all rights reserved