This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00028103


Marker Name:  S0035 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: not available  

PCR Primers

Primer: GGCCGTCTTATACTCTCAGCATA
Primer: CCAAATAAACAGCAGGCAGCCT
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00009165

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Cao, H et al. 2004: 1 Pig
chromosome 6
827.700 827.700 827.700
ENSEMBL56 Sscrofa9 Pig Assembly: 6 Pig
chromosome 6
1042709.000 1042798.500 1042888.000
ENSEMBL67 Ssc10.2 Pig Assembly: 6 Pig
chromosome 6
2352681.000 2352770.500 2352860.000


© The Roslin Institute 2007-2012, all rights reserved