This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00028101


Marker Name:  HSD17B2 
Species:  Pig
Marker Type:  PCR-STS
Publication ID: not available  

PCR Primers

Primer: CCTCGACTGCGTACCAATTCCATGCTTTGTCCAAGTATC
Primer: CATCTCTTATCTGCTGCGAGTTGGT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW312396
has an Associated Sequence: Sequence Genbank ID: AW785511

Related Markers

This Marker is Associated with Gene HSD17B2
This Marker is Associated with Gene HSD17B2

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Cao, H et al. 2004: 1 Pig
chromosome 6
713.700 713.700 713.700


© The Roslin Institute 2007-2012, all rights reserved