This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00028094


Marker Name:  GOT2 
Species:  Pig
Marker Type:  PCR-STS
Publication ID: not available  

PCR Primers

Primer: CCTCGACTGCGTACCAATTCCGTCTCTGCCAGTCCTATGC
Primer: CGTTGACAGGAGGGTTGGAATACAT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: M11732

Related Markers

This Marker is Associated with Gene GOT2
This Marker is Associated with Gene GOT2

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Cao, H et al. 2004: 1 Pig
chromosome 6
347.100 347.100 347.100


© The Roslin Institute 2007-2012, all rights reserved