This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00028091


Marker Name:  DHODH 
Species:  Pig
Marker Type:  PCR-STS
Publication ID: not available  

PCR Primers

Primer: CCTCGACTGCGTACCAATTCCGGAGAGGGATGCCTTGAA
Primer: ACTGTGGTGTTCGTGACAATCAGTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: BI343408
has an Associated Sequence: Sequence Genbank ID: AW486848

Related Markers

This Marker is Associated with Gene DHODH
This Marker is Associated with Gene DHODH

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Cao, H et al. 2004: 1 Pig
chromosome 6
186.700 186.700 186.700


© The Roslin Institute 2007-2012, all rights reserved