This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00026815


Marker Name:  HUR0411 
Species:  Chicken
Marker Type:  Microsatellite
Publication ID: 16573536

PCR Primers

Primer: CTGTTCTGCATTTTAGTTTG
Primer: AATTTGTACTTGTTCCTTCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: BV680368
has an Associated Sequence: Local Sequence ID: ARKFSQ00004043

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Ben-Avraham, D. et al 2006 (M): Z Chicken
chromosome Z
169.000 169.000 169.000
ENSEMBL53 WASHUC2 Chicken Assembly: Z Chicken
chromosome Z
55035172.000 55035250.000 55035328.000
ENSEMBL71 Galgal4 Chick Assembly: Z Chicken
chromosome Z
55985534.000 55985612.000 55985690.000


© The Roslin Institute 2007-2012, all rights reserved