This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00026579


Marker Name:  UW63 
Species:  Cow
Marker Type:  UNKNOWN
Publication ID: 15466297

PCR Primers

Primer: TGGGCAGAGGAGCCTAAT
Primer: TCACTTTCCACTTTCATGCAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF004390
has an Associated Sequence: Local Sequence ID: ARKFSQ00007942
has an Associated Sequence: Local Sequence ID: ARKFSQ00000578

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
1198.200 1198.200 1198.200
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
51962486.000 51962608.000 51962730.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
49910657.000 49910779.000 49910901.000
Itoh, Tomohito et al. 2005: 8 Cow
chromosome 8
305.740 305.740 305.740
MARC2004 (A): 8 Cow
chromosome 8
54.649 54.649 54.649
Mckay S.D. et al 2007: 8 Cow
chromosome 8
1600.600 1600.600 1600.600
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
49.900 49.900 49.900


© The Roslin Institute 2007-2012, all rights reserved