This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00026361


Marker Name:  TGLA37 
Species:  Cow
Marker Type:  UNKNOWN
Publication ID: 15466297

PCR Primers

Primer: CATTCCAATCCCCTATCCTGAG
Primer: TTGAATGATTCTATGAAGACCTGTA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00002980
has an Associated Sequence: Local Sequence ID: ARKFSQ00007928
has an Associated Sequence: Local Sequence ID: ARKFSQ00007927

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 6 Cow
chromosome 6
462.800 462.800 462.800
ENSEMBL54 Btau_4.0 Cow Assembly: 13 Cow
chromosome 13
69441730.000 69441786.000 69441842.000
ENSEMBL54 Btau_4.0 Cow Assembly: 6 Cow
chromosome 6
52471030.000 52471086.000 52471142.000
ENSEMBL66 UMD3.1 Cow Assembly: 6 Cow
chromosome 6
52554008.000 52554062.000 52554116.000
MARC2004 (A): 6 Cow
chromosome 6
59.736 59.736 59.736
Mckay S.D. et al 2007: 6 Cow
chromosome 6
833.600 833.600 833.600
Snelling, W et al. 2006 (Composite): 6 Cow
chromosome 6
49.900 49.900 49.900


© The Roslin Institute 2007-2012, all rights reserved