This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00025550


Marker Name:  AF5 
Species:  Cow
Marker Type:  UNKNOWN
Publication ID: 15466297

PCR Primers

Primer: GCAGAAGGAAAAAGCAATGG
Primer: GATCCTGCGAGCCACAAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: BTDR29

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 25 Cow
chromosome 25
1743.600 1743.600 1743.600
ILTXRH2004: 25_B Cow
chromosome 25
77.200 77.200 77.200
ILTXRH2005: 25 Cow
chromosome 25
646.000 646.000 646.000
Itoh, Tomohito et al. 2005: 25 Cow
chromosome 25
482.120 482.120 482.120
MARC2004 (A): 25 Cow
chromosome 25
61.669 61.669 61.669
Mckay S.D. et al 2007: 25 Cow
chromosome 25
1547.000 1547.000 1547.000
Snelling, W et al. 2006 (Composite): 25 Cow
chromosome 25
64.300 64.300 64.300


© The Roslin Institute 2007-2012, all rights reserved