This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00022857


Marker Name:  RM074 
Species:  Cow
Marker Type:  PCR-STS
Publication ID: 15231756

PCR Primers

Primer: ATTTATCCGTCTGTGCCATTACCT
Primer: GTGCTGATGCACTCTCCATATC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U32915
has an Associated Sequence: Local Sequence ID: ARKFSQ00007776
has an Associated Sequence: Local Sequence ID: ARKFSQ00003054

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 25 Cow
chromosome 25
507.300 507.300 507.300
ENSEMBL54 Btau_4.0 Cow Assembly: 25 Cow
chromosome 25
4519239.000 4519320.000 4519401.000
ENSEMBL66 UMD3.1 Cow Assembly: 25 Cow
chromosome 25
3912870.000 3912951.000 3913032.000
ILTXRH2004: 25_A Cow
chromosome 25
4.470 4.470 4.470
ILTXRH2005: 25 Cow
chromosome 25
0.000 0.000 0.000
Mckay S.D. et al 2007: 25 Cow
chromosome 25
138.600 138.600 138.600
Snelling, W et al. 2006 (Composite): 25 Cow
chromosome 25
7.600 7.600 7.600


© The Roslin Institute 2007-2012, all rights reserved