This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00018751


Marker Name:  UWCA47 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 17087818

PCR Primers

Primer: GGAAAGTCCTTAGATGGAGAATTGT
Primer: TTGAGAACTTGTCCCGAGAGAA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: BOVREPAP
has an Associated Sequence: Local Sequence ID: ARKFSQ00003071
has an Associated Sequence: Local Sequence ID: ARKFSQ00005795

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
81.000 81.000 81.000
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
961998.000 962056.000 962114.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
1101061.000 1101119.000 1101177.000
Mckay S.D. et al 2007: 8 Cow
chromosome 8
108.400 108.400 108.400
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
0.000 0.000 0.000


© The Roslin Institute 2007-2012, all rights reserved