This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00018738


Marker Name:  ACO1 
Species:  Cow
Marker Type:  UNKNOWN
Publication ID: 17087818

PCR Primers

Primer: TCCTTACCATTTTCTATCAGAGTTC
Primer: ATGACTCGGGCAGGCTTAAA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00000757
has an Associated Sequence: Local Sequence ID: ARKFSQ00005786

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
540.600 540.600 540.600
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
11735003.000 11735078.500 11735154.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
11514295.000 11514370.500 11514446.000


© The Roslin Institute 2007-2012, all rights reserved