This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00018707


Marker Name:  TPM2 
Species:  Cow
Marker Type:  EST
Publication ID: 17087818

PCR Primers

Primer: CATGGACGCCATCAAGAAG
Primer: ACTTTTCCACCTCGTCCTCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00005777
has an Associated Sequence: Sequence Genbank ID: CO895721
has an Associated Sequence: Local Sequence ID: ARKFSQ00002125

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
1528.600 1528.600 1528.600
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
62518810.000 62519123.500 62519437.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
60274094.000 60274407.500 60274721.000


© The Roslin Institute 2007-2012, all rights reserved