This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00018701


Marker Name:  ALG2 
Species:  Cow
Marker Type:  EST
Publication ID: 17087818

PCR Primers

Primer: AACCACCTGCAATGATCAGA
Primer: CCAGACGGCGTAAGAAAATC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00005772
has an Associated Sequence: Sequence Genbank ID: CO875906

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
1670.400 1670.400 1670.400
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
67060512.000 67060726.000 67060940.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
64719480.000 64719694.000 64719908.000


© The Roslin Institute 2007-2012, all rights reserved