This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00018698


Marker Name:  FRMPD1 
Species:  Cow
Marker Type:  EST
Publication ID: 17087818

PCR Primers

Primer: GACAAAGACACCCTCCTCCA
Primer: GGCAGGCTCATCATTCATCT
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00005770
has an Associated Sequence: Local Sequence ID: ARKFSQ00001863
has an Associated Sequence: Sequence Genbank ID: AV596222

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
1715.700 1715.700 1715.700
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
64607025.000 64607525.000 64608025.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
62286072.000 62286572.000 62287072.000


© The Roslin Institute 2007-2012, all rights reserved