This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00018695


Marker Name:  HR 
Species:  Cow
Marker Type:  BES
Publication ID: 17087818

PCR Primers

Primer: GAGCGTCACTCAGCACTTCCTGTC
Primer: TGGACCCAGCTCTGCTTGATGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AAFC02050291
has an Associated Sequence: Sequence Genbank ID: CO893659
has an Associated Sequence: Local Sequence ID: ARKFSQ00005768
has an Associated Sequence: Local Sequence ID: ARKFSQ00001935

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
1756.700 1756.700 1756.700
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
72496168.000 72496254.500 72496341.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
69931718.000 69931804.500 69931891.000
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
68.800 68.800 68.800


© The Roslin Institute 2007-2012, all rights reserved