This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00018693


Marker Name:  BZ872334 
Species:  Cow
Marker Type:  BES
Publication ID: 17087818

PCR Primers

Primer: TTTCTTACTCTCTGGATGGAATCG
Primer: GAGCCCACATACCAAAACTAGAGA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: BZ872334
has an Associated Sequence: Local Sequence ID: ARKFSQ00005767
has an Associated Sequence: Local Sequence ID: ARKFSQ00001733

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
1800.300 1800.300 1800.300
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
74036117.000 74036360.500 74036604.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
71345126.000 71345369.500 71345613.000
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
75.500 75.500 77.700


© The Roslin Institute 2007-2012, all rights reserved