This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00018692


Marker Name:  CC522613 
Species:  Cow
Marker Type:  BES
Publication ID: 17087818

PCR Primers

Primer: CAGAAGAGATGGTGAGAAGTGAAA
Primer: GTCTCTGCCCTTAAACATATCCAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: CC522613
has an Associated Sequence: Local Sequence ID: ARKFSQ00005766
has an Associated Sequence: Local Sequence ID: ARKFSQ00002774

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
1803.900 1803.900 1803.900
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
74115270.000 74115508.500 74115747.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
71439748.000 71439986.500 71440225.000
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
75.500 75.500 77.700


© The Roslin Institute 2007-2012, all rights reserved