This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00018676


Marker Name:  DIK74 
Species:  Cow
Marker Type:  Microsatellite
Publication ID: 17087818

PCR Primers

Primer: GGAGTGTGGGGACAGTAGAG
Primer: GGAAAGATAAACACGGAGAGAG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00005749
has an Associated Sequence: Local Sequence ID: ARKFSQ00001815

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
2159.900 2159.900 2159.900
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
98245254.000 98245313.500 98245373.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
94966387.000 94966446.500 94966506.000
Mckay S.D. et al 2007: 8 Cow
chromosome 8
2992.400 2992.400 2992.400
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
112.400 112.400 112.400


© The Roslin Institute 2007-2012, all rights reserved