This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00018671


Marker Name:  EPB72 
Species:  Cow
Marker Type:  EST
Publication ID: 17087818

PCR Primers

Primer: CAAACATCACCAACGCTGAC
Primer: GCAGCTTCACGTCCTTGATT
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00005747
has an Associated Sequence: Local Sequence ID: ARKFSQ00002054

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 8 Cow
chromosome 8
2343.500 2343.500 2343.500
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
116278187.000 116278865.500 116279544.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
112657375.000 112658053.500 112658732.000
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
131.700 131.700 131.700


© The Roslin Institute 2007-2012, all rights reserved