This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00017740


Marker Name:  TXN 
Species:  Cow
Marker Type:  UNKNOWN
Publication ID: 17087818

PCR Primers

Primer: CCTTATTAGCTCCAGAAAATTCAC
Primer: GCAGAGTGTGAAGTCAAATGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00004980
has an Associated Sequence: Sequence Genbank ID: CO875528
has an Associated Sequence: Local Sequence ID: ARKFSQ00003164

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 2 Cow
chromosome 2
1276.000 1276.000 1276.000
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
104842414.000 104842681.500 104842949.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
101485063.000 101485330.500 101485598.000
Snelling, W et al. 2006 (Composite): 8 Cow
chromosome 8
110.800 112.800 112.800


© The Roslin Institute 2007-2012, all rights reserved