This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00017739


Marker Name:  CTNNAL1 
Species:  Cow
Marker Type:  EST
Publication ID: 17087818

PCR Primers

Primer: GAAACACTTGATTCTGTAAAGGTGTC
Primer: TTTTTGCTGAAGAGGGCTTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: CO874458
has an Associated Sequence: Local Sequence ID: ARKFSQ00004979

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
BovGen_RH (2006): 2 Cow
chromosome 2
1284.100 1284.100 1284.100
ENSEMBL54 Btau_4.0 Cow Assembly: 8 Cow
chromosome 8
103602038.000 103602192.500 103602347.000
ENSEMBL66 UMD3.1 Cow Assembly: 8 Cow
chromosome 8
100222912.000 100223066.500 100223221.000


© The Roslin Institute 2007-2012, all rights reserved