This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014319


Marker Name:  BGN 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: caggaaaggctcagggagag
Primer: TTCAAAGCCACTGTTCTCCAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U82178

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: X Cat
chromosome X
821.400 821.400 821.400


© The Roslin Institute 2007-2012, all rights reserved