This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014292


Marker Name:  AMELX 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: TTCCCATTACCAGCTTCCTG
Primer: CCCCAACTTTTACAGGCTGA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF114709

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: X Cat
chromosome X
140.100 140.100 140.100
Murphy et al 2006: X Cat
chromosome X
25.500 25.500 25.500


© The Roslin Institute 2007-2012, all rights reserved