This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014288


Marker Name:  TG 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CAGAGCCTCAACGAGATTCC
Primer: CTGAGCCCAGCAGACTGAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF071756

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: F2 Cat
chromosome F2
630.300 630.300 630.300
Murphy et al 2006: F2 Cat
chromosome F2
680.200 680.200 680.200


© The Roslin Institute 2007-2012, all rights reserved