This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014285


Marker Name:  FCA750 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TTGGCCATGAGTTCAAGGTT
Primer: TTGGCCATGAGTTCAAGGTT
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: F2 Cat
chromosome F2
624.400 624.400 624.400
Murphy et al 2006: F2 Cat
chromosome F2
696.700 696.700 696.700


© The Roslin Institute 2007-2012, all rights reserved