This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014272


Marker Name:  FCA1036 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CTCTGCATCAGTGCCGTG
Primer: TGTTTTGCTTCTAAAATGCAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY435016

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: F2 Cat
chromosome F2
145.900 145.900 145.900
Murphy et al 2006: F2 Cat
chromosome F2
140.400 140.400 140.400


© The Roslin Institute 2007-2012, all rights reserved