This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014266


Marker Name:  FCA1033 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CCGTCTTTTTGCCAAGTTGT
Primer: CTTCGTTTCCCAATCCCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY435013

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: F1 Cat
chromosome F1
664.900 664.900 664.900
Murphy et al 2006: F1 Cat
chromosome F1
829.100 829.100 829.100


© The Roslin Institute 2007-2012, all rights reserved