This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014246


Marker Name:  FCA1022 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CTAGTTCCAGCCTCCAGCAC
Primer: CTGCCCTTGGGAGTTCCT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AY435002

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: F1 Cat
chromosome F1
370.800 370.800 370.800
Murphy et al 2006: F1 Cat
chromosome F1
403.600 403.600 403.600


© The Roslin Institute 2007-2012, all rights reserved