This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014234


Marker Name:  Fc.97375 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GGATCCAAATGTGATCTCAGC
Primer: GCACTTGGCCTCAGAAAGAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646945

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: F1 Cat
chromosome F1
89.400 89.400 89.400
Murphy et al 2006: F1 Cat
chromosome F1
194.300 194.300 194.300


© The Roslin Institute 2007-2012, all rights reserved