This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014231


Marker Name:  NY-CO-7 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GGGCTCACAGATTTTATTACAGG
Primer: ACCTGTCTGGGCCAAAAAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646752

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: E3 Cat
chromosome E3
633.100 633.100 633.100
Murphy et al 2006: E3 Cat
chromosome E3
674.300 674.300 674.300


© The Roslin Institute 2007-2012, all rights reserved