This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014230


Marker Name:  PM5 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: AGATACAGGCTGTGCGGTTT
Primer: CAGCGCTCGTTTGTGAGAAT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646751

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: E3 Cat
chromosome E3
552.900 552.900 552.900
Murphy et al 2006: E3 Cat
chromosome E3
587.200 587.200 587.200


© The Roslin Institute 2007-2012, all rights reserved