This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00014227


Marker Name:  Fc.28607 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CAGCAGCTGGCTGATTTCTT
Primer: GGCCAAGGCCTGTAGAAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646941

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003: E3 Cat
chromosome E3
460.900 460.900 460.900
Murphy et al 2006: E3 Cat
chromosome E3
423.700 423.700 423.700


© The Roslin Institute 2007-2012, all rights reserved